Prev. | 

RIKEN DNA Bank Human Resource - DMTN

Gene ID NCBI Gene 2039 |  KEGG hsa:2039
Gene Symbol DMTN
Protein Name dematin actin binding protein
Synonyms DMT|EPB49
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086963 IRAL017G19 pOTB7 BC006318 NM_001978 Full/var
HGY089037 IRAL022J21 pOTB7 BC017445 NM_001978 Full/var
HGY098970 IRAL047H02 pOTB7 BC052805 NM_001978 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180408 ARi51A08 pGCAP10 NM_001978.2  
GGAGGCGCAGGCGAGGGCCCTGCGGAGCCCGGCGGAGCCCGGGCGGCCCGCGGACGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl