Prev. |  KEGG KO K06107 > 

RIKEN DNA Bank Human Resource - EPB41L2

Gene ID NCBI Gene 2037 |  KEGG hsa:2037
Gene Symbol EPB41L2
Protein Name erythrocyte membrane protein band 4.1 like 2
Synonyms 4.1-G|4.1G
Ortholog resource in our bank

  EPB41L2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005370 IRAK013H02 pCMV-SPORT6 BC034718 NM_001431 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR176102 ARi40E06 pGCAP10 NM_001431.3  
GGACGGCCCCAGTCAGGGAATTTCAATTTGAAACCTAGCGGAGGGAGGAGGCAGGCGCGG
HKR441934 RBdS104N22 pGCAP10 NM_001431.3  
GACTGAAGAGGGACGGGTCCCGCGGCGAGCGAGCTCCTGAGGTACGGCGTCGGGCATAAG
HKR453051 RBdS132K11 pGCAP10 NM_001431.3  
GGGGGCCGGCCCTCAGAGTCCTCTGACGGCCCCAGTCAGGGAATTTCAATTTGAAACCTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl