Prev. | 

RIKEN DNA Bank Human Resource - ENSA

Gene ID NCBI Gene 2029 |  KEGG hsa:2029
Gene Symbol ENSA
Protein Name endosulfine alpha
Synonyms ARPP-19e
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY067146 IRAK167O10 pBluescriptR BC068544 NM_207044 Full/var
HGY080473 IRAL001D01 pOTB7 BC000436 NM_207044 Full
HGY083617 IRAL009A17 pOTB7 BC004461 NM_207044 Full
HGY101699 IRAL054E03 pOTB7 BC069208 NM_207168 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028080 W01A070D08 pENTR-TOPO flj0037d23 AK001981 NM_207044  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR377210 RBd43A10 pGCAP10 NM_004436.2  
GTGTCCCCGTTTCCCCTCCCCCTTCCCTTCTCCGGTTGCCTTCCCGGGCCCCTTACACTC
HKR394975 RBd87H07 pGCAP10 NM_004436.2  
TGTAGTGACAGGAGCCGAAGCAGCAGCGCAGGTTGTCCCCGTTTCCCCTCCCCCTTCCCT
HKR406181 RBdS015H13 pGCAP10 NM_004436.2  
GACTGAGCAACCCTAGTGACAGGAGCCGAAGCAGCAGCGCAGGTTGTCCCCGTTTCCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl