Prev. |  KEGG KO K01689 > 

RIKEN DNA Bank Human Resource - ENO3

Gene ID NCBI Gene 2027 |  KEGG hsa:2027
Gene Symbol ENO3
Protein Name enolase 3
Synonyms GSD13|MSE
Ortholog resources KEGG ortholog (KEGG orthology K01689) in the DNA Bank
Featured content HIF-1 signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095845 IRAL039K05 pOTB7 BC017249 NM_053013 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR430010 RBdS075A10 pGCAP10 NM_001976.3  
GGACACTGTCCCAGCTGCCACCTAGACTCGGAGCTCCATCCAAACCTCCAGCGAAGACAT
HKR452895 RBdS132D23 pGCAP10 NM_001976.3  
GGACACTGTCCCAGCTGCCACCTAGACTCGGAGCTCCATCCAAACCTCCAGCGAAGACAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl