Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - ENO2

Gene ID (NCBI) 2026
Gene Symbol ENO2
Protein Name enolase 2 (gamma, neuronal)
Synonyms HEL-S-279|NSE
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01689)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085052 IRAL012K12 pOTB7 BC002745 NM_001975 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043205 ARe08A05 pKA1U5 NM_001975.2  
GGCCACTCCCGCTCTCTCAGCGCCGCCGTCGCCACCGCCACCGCCACCGCCACTACCACC
HKR082436 ARf06B12 pKA1U5 NM_001975.2  
GGGGAGCCGCAGCCGCCGCCGCCACATGCCACTCCCGTTTATNATCAGCGCCGCCGTCGC
HKR053603 ARe34A03 pKA1U5 NM_001975.2  
GGCTCTCTCAGCGCCGCCGTTCGCCACCGCCACCGCCACCGCCACTACCACCGTCTGAGT
HKR364908 RBd12E12 pGCAP10 NM_001975.2  
GCCGGGAGCCGCAGCCGCCGCCGCCACTGCCACTCCCGCTCTCTCAGCGCCGCCGTCGCC
HKR372978 RBd32H10 pGCAP10 NM_001975.2  
GGGAGATCCCAGCCATCATGTCCATAGAGAAGATCTGGGCCCGGGAGATCCTGGACTCCC
HKR374878 RBd37D06 pGCAP10 NM_001975.2  
GACTCCCGCTCTCTCAGCGCCGCCGTCGCCACCGCCACCGCCACCGCCACTACCACCGTT
HKR379778 RBd49H10 pGCAP10 NM_001975.2  
AGGAGATCCCAGCCATCATGTCCATAGAGAAGATCTGGGCCCGGGAGATCCTGGACTCCC
HKR382945 RBd57G01 pGCAP10 NM_001975.2  
GCCCGCTCTCTCAGCGCCGCCGTCGCCACCGCCACCGCCACCGCCACTACCACCGTCTGA
HKR388151 RBd70G07 pGCAP10 NM_001975.2  
GACTGCCACTCCCGCTCTCTCAGCGCCGCCGTCGCCACCGCCACCGCCACCGCCACTACC
HKR441868 RBdS104L04 pGCAP10 NM_001975.2  
GCTCTCAGCGCCGCCGTCGCCACCGCCACCGCCACCGCCACTACCACCGTCTGAGTCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl