Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - ENO1

Gene ID (NCBI) 2023
Gene Symbol ENO1
Protein Name enolase 1, (alpha)
Synonyms ENO1L1|MPB1|NNE|PPH
Databases KEGG link 01 |  NCBI Gene link 01
Featured content HIF-1 signaling pathway - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01689)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX007943 IRAK019O07 pCMV-SPORT6 BC011130 NM_001428 Full
HGY012979 IRAK032H11 pBluescriptR BC022545 NM_001428 Full
HGX044205 IRAK110I13 pCMV-SPORT6 BC050642 NM_001428 Full
HGX069782 IRAK174H14 pCMV-SPORT6 BC073991 NM_001428 Partial
HGY081039 IRAL002J23 pOTB7 BC001810 NM_001428 Full
HGY081049 IRAL002K09 pOTB7 BC009912 NM_001428 Full
HGY083663 IRAL009C15 pOTB7 BC004458 NM_001428 Full
HGY085310 IRAL013E14 pOTB7 BC004325 NM_001428 Partial
HGY089832 IRAL024J16 pOTB7 BC021166 NM_001428 Partial
HGY090028 IRAL025B04 pOTB7 BC009218 NM_001428 Partial
HGY093304 IRAL033E08 pOTB7 BC015641 NM_001428 Full
HGY093538 IRAL033O02 pOTB7 BC027725 NM_001428 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001738 W01A004F18 pENTR-TOPO IRAL002J23 BC001810 NM_001428  
HGE001742 W01A004F22 pENTR-TOPO IRAL002J23 BC001810 NM_001428  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041283 ARe03D11 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR042130 ARe05F10 pKA1U5 NM_001428.2  
GGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGCAGCACCCT
HKR043655 ARe09C07 pKA1U5 NM_001428.2  
TGGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGCAGC
HKR044907 ARe12E11 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR046531 ARe16F11 pKA1U5 NM_001428.2  
GGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGT
HKR047675 ARe19D03 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCNCGCCGGCTTTACGTTCACCTCGGTGTC
HKR047698 ARe19E02 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR164508 ARi11E12 pGCAP10 NM_001428.2  
TTGAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTG
HKR165307 ARi13E11 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR048457 ARe21C09 pKA1U5 NM_001428.2  
GATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGC
HKR048949 ARe22G05 pKA1U5 NM_001428.2  
GGAACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGG
HKR050569 ARe26H01 pKA1U5 NM_001428.2  
TGGAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTG
HKR051209 ARe28A09 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR169281 ARi23D09 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTANGTTCACCTCGGTGTC
HKR169302 ARi23E06 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTANGTTCACCTCGGTGTC
HKR171705 ARi29E09 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR171726 ARi29F06 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR054180 ARe35H12 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGNCGGCTTTACGTTCACCTCGGTGTC
HKR054878 ARe37D06 pKA1U5 NM_001428.2  
ATCCTGGAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTC
HKR056032 ARe40B08 pKA1U5 NM_001428.2  
TGACGTTCACCTCGGTGTCTGCAGCACCCTCCGCATTCCTCTCCTAGGCGACGAGACCCA
HKR056898 ARe42E02 pKA1U5 NM_001428.2  
GGCCGGCTTTACGTTCACCTCGGTGTCTGCAGCACCCTCCGCTTCCTCTCCTAGGCGACG
HKR056979 ARe42H11 pKA1U5 NM_001428.2  
AGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCNGCATTTACGTTCACCTCGGTGTC
HKR176482 ARi41D10 pGCAP10 NM_001428.2  
GATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGC
HKR176552 ARi41G08 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR177232 ARi43B08 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR177751 ARi44G07 pGCAP10 NM_001428.2  
GGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGG
HKR178035 ARi45B11 pGCAP10 NM_001428.2  
GATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGC
HKR060030 ARe50B06 pKA1U5 NM_001428.2  
GGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGG
HKR060106 ARe50E10 pKA1U5 NM_001428.2  
GAGTATCTGCTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGT
HKR061351 ARe53G07 pKA1U5 NM_001428.2  
GGGCGCGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCAC
HKR061603 ARe54A03 pKA1U5 NM_001428.2  
GGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGG
HKR180877 ARi52D05 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR067630 ARe69B06 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR184099 ARi60E03 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR185753 ARi64G09 pGCAP10 NM_001428.2  
HKR186929 ARi67F09 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR068531 ARe71F11 pKA1U5 NM_001428.2  
TGGGCGCGGACAGTATCTGTGGGTACCCGGAGCACNGAGATCTCGCCGGCTTTACGTTCA
HKR068956 ARe72G12 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCNGGCTTTACGTTCACCTCGGTGTC
HKR188525 ARi71F05 pGCAP10 NM_001428.2  
GGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGT
HKR072571 ARe81H03 pKA1U5 NM_001428.2  
GGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGCAGCA
HKR073747 ARe84G03 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR074101 ARe85E05 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR076971 ARe92H03 pKA1U5 NM_001428.2  
TGATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTG
HKR077204 ARe93A04 pKA1U5 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR078075 ARe95D03 pKA1U5 NM_001428.2  
TTGATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCT
HKR079372 ARe98H04 pKA1U5 NM_001428.2  
AGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCT
HKR205259 ARiS013C11 pGCAP10 NM_001428.2  
GATCTGTGNGTACCCNGNGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGC
HKR205470 ARiS013L06 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR205519 ARiS013N07 pGCAP10 NM_001428.2  
GATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGC
HKR209281 ARiS023D09 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR209325 ARiS023F05 pGCAP10 NM_001428.2  
GGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGG
HKR209330 ARiS023F10 pGCAP10 NM_001428.2  
GGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGT
HKR209419 ARiS023J03 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR218250 ARiS045K10 pGCAP10 NM_001428.2  
GATCTNNNCGTACCNGGAGCTCGTANATCTCGCCGGNTTTACATTCNCCNCGGTGTCTGC
HKR218300 ARiS045M12 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR222062 ARiS055C14 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR222277 ARiS055L13 pGCAP10 NM_001428.2  
GGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGT
HKR235431 ARiS088J15 pGCAP10 NM_001428.2  
AGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCT
HKR243779 ARiS109H11 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR247245 ARiS118B21 pGCAP10 NM_001428.2  
CGGCCGGCCGATGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACG
HKR249022 ARiS122J06 pGCAP10 NM_001428.2  
CGGCCGGCCGATCCGGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCT
HKR249136 ARiS122N24 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR260018 ARiS150A18 pGCAP10 NM_001428.2  
GGCCGGCTTTACGTTCACCTCGGTGTCTGCAGCACCCTCCGCTTCCTCTCCTAGGCGACG
HKR264594 ARiS161I02 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR264766 ARiS161P06 pGCAP10 NM_001428.2  
GACGTTCACCTCGGTGTCTGCAGCACCCTCCGCTTCCTCTCCTAGGCGACGAGACCCAGT
HKR276549 ARiS191G05 pGCAP10 NM_001428.2  
GGCGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTC
HKR276609 ARiS191I17 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR277953 ARiS194O17 pGCAP10 NM_001428.2  
GAGTATCTGTGGNTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR279268 ARiS198C20 pGCAP10 NM_001428.2  
HKR279575 ARiS198P15 pGCAP10 NM_001428.2  
GGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGCAGCACCCTCCGCTT
HKR320430 RBb01B06 pKA1U5 NM_001428.2  
GGGCGCGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCAC
HKR324555 RBb11G11 pKA1U5 NM_001428.2  
HKR366505 RBd16E09 pGCAP10 NM_001428.2  
GGGCGCGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCAC
HKR372570 RBd31H02 pGCAP10 NM_001428.2  
GGCGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTC
HKR373680 RBd34D08 pGCAP10 NM_001428.2  
GACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGCAGCACCCTCC
HKR374077 RBd35D05 pGCAP10 NM_001428.2  
GGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGG
HKR337724 RBb44F04 pGCAP1 NM_001428.2  
AGGAAGTCGGCGCGGGCGGCGCGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCG
HKR339653 RBb49C05 pGCAP1 NM_001428.2  
GACAGNTATCTGTGGGTACCCGGNAGCACGGNAGTATCTCGCCGGCNTTTACGATTCACC
HKR376569 RBd41H01 pGCAP10 NM_001428.2  
GGGCTTTACGTTCACCTCGGTGTCTGCAGCACCCTCCGCTTCCTCTCCTAGGCGACGAGA
HKR346807 RBb67A07 pGCAP1 NM_001428.2  
AGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCT
HKR346858 RBb67C10 pGCAP1 NM_001428.2  
GGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGT
HKR384827 RBd62B03 pGCAP10 NM_001428.2  
GATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGC
HKR386850 RBd67C02 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR390101 RBd75E05 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR395708 RBd89E12 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR399370 RBd98H02 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR399376 RBd98H08 pGCAP10 NM_001428.2  
GAGCTAGGCAGGAAGTCGGCGCGGGCGGCGCGGACAGTATCTGTGGGTACCCGGAGCACG
HKR405932 RBdS014N20 pGCAP10 NM_001428.2  
GCTCGCCGGCTTTACGTTCACCTCGGTGTCTGCAGCACCCTCCGCTTCCTCTCCTAGGCG
HKR416346 RBdS040O10 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR420617 RBdS051J01 pGCAP10 NM_001428.2  
AGAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGT
HKR432465 RBdS081C17 pGCAP10 NM_001428.2  
GNGGAAGTCGGNTCGGNCNNCGCGGACAGNATCNGNGGGTACCCGGANNANGGANATCTC
HKR432550 RBdS081G06 pGCAP10 NM_001428.2  
TGGATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCT
HKR432704 RBdS081M16 pGCAP10 NM_001428.2  
GGTCGGCGCGGGCGGCGCGGACAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGG
HKR432713 RBdS081N01 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR432748 RBdS081O12 pGCAP10 NM_001428.2  
GATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTCTGC
HKR441961 RBdS104P01 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC
HKR475157 RBdS187O21 pGCAP10 NM_001428.2  
GAGTATCTGTGGGTACCCGGAGCACGGAGATCTCGCCGGCTTTACGTTCACCTCGGTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl