Prev. |  KEGG KO K01173 > 

RIKEN DNA Bank Human Resource - ENDOG

Gene ID NCBI Gene 2021 |  KEGG hsa:2021
Gene Symbol ENDOG
Protein Name endonuclease G
Synonyms -
Featured content Apoptosis - human
Ortholog resource in our bank

  ENDOG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084780 IRAL011P20 pOTB7 BC004922 NM_004435 Full/var
HGY093055 IRAL032K15 pDNR-LIB BC016351 NM_004435 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098029 M01C045B05 pDONR221 MGC12-C03 BC004922 NM_004435  
HGE098077 M01C045D05 pDONR221 MGC12-C03 BC004922 NM_004435  
HGE098125 M01C045F05 pDONR221 MGC12-C03 BC004922 NM_004435  
HGE098173 M01C045H05 pDONR221 MGC12-C03 BC004922 NM_004435  
HGE098221 M01C045J05 pDONR221 MGC12-C03 BC004922 NM_004435  
HGE098269 M01C045L05 pDONR221 MGC12-C03 BC004922 NM_004435  
HGE098317 M01C045N05 pDONR221 MGC12-C03 BC004922 NM_004435  
HGE098365 M01C045P05 pDONR221 MGC12-C03 BC004922 NM_004435  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247357 ARiS118G13 pGCAP10 NM_004435.2  
GACACCCGGTTGGGCTCTGCTGCTCCCTTCTGGGTTCCGAGGCCCAAGCCCTTGGCAGTG
HKR364977 RBd12H09 pGCAP10 NM_004435.2  
GACACCCGGTTGGGCTCTGCTGCTCCCTTCTGGGTTCCGAGGCCCAAGCCCTTGGCAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl