Prev. |  KEGG KO K06106 > 

RIKEN DNA Bank Human Resource - CTTN

Gene ID NCBI Gene 2017 |  KEGG hsa:2017
Gene Symbol CTTN
Protein Name cortactin
Synonyms EMS1
Ortholog resources KEGG ortholog (KEGG orthology K06106) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018670 IRAK046L06 pBluescriptR BC033889 NM_138565 Partial/var
HGY084986 IRAL012H18 pOTB7 BC008799 NM_138565 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167653 ARi19C05 pGCAP10 NM_005231.3  
CGGCCGGCCGATGAGAGCCTGGCGCCTGGGAGCGGCTGGCGCGGCGGAATCCAGGGCCGA
HKR170403 ARi26A03 pGCAP10 NM_005231.3  
TNGAAGCGACTCCTCCCGTCCATNANGGGCTGGCCCGGCGGNCTCCAAGGCCCACCCGGG
HKR178060 ARi45C12 pGCAP10 NM_005231.3  
GGTGCCTGGGAGCGGCTGGCGCGGCGGAATCCAGGGCCGACCCGGGCCGGACCGACCCCA
HKR222275 ARiS055L11 pGCAP10 NM_005231.3  
GACCGGAANTANAGCCTGGTGCCTGGGAGCGGCTGGCGCGGCGGAATCCAGGGCCGACCC
HKR235274 ARiS088D02 pGCAP10 NM_005231.3  
GCTGGCGCCTGGGAGCGGCTGGCGCGGCGGAATCCAGGGCCGACCCGGGCCGGACCGACC
HKR279499 ARiS198M11 pGCAP10 NM_005231.3  
GATNNCCTGGCGCCTGNNAGCGGCTGGCGCGNCNGAATCCAGGGCCGACCCGGGCCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl