Prev. | 

RIKEN DNA Bank Human Resource - EMP2

Gene ID NCBI Gene 2013 |  KEGG hsa:2013
Gene Symbol EMP2
Protein Name epithelial membrane protein 2
Synonyms XMP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005788 IRAK014H20 pCMV-SPORT6 BC009687 NM_001424 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR066125 ARe65F05 pKA1U5 NM_001424.4  
GAGCCCAGAGCTTCAAAACAGCCCGGCGGCCTCGCCTCGCACCCCCAGCCAGATCCGTCG
HKR182857 ARi57C09 pGCAP10 NM_001424.4  
GAGCTTCAAAACAGCCCGGCGGCCTCGCCTCGCACCCCCAGCCAGTCCGTCGATCCAGCT
HKR184476 ARi61D04 pGCAP10 NM_001424.4  
TGGACCCCCAGCCAGTCCGTCGATCCAGCTGCCAGCGCAGCCGCCAGCGCCGGCACATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl