Prev. |  KEGG KO K08798 > 

RIKEN DNA Bank Human Resource - MARK2

Gene ID NCBI Gene 2011 |  KEGG hsa:2011
Gene Symbol MARK2
Protein Name microtubule affinity regulating kinase 2
Synonyms EMK-1|EMK1|PAR-1|Par-1b|Par1b
Ortholog resource in our bank

  MARK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081940 IRAL004O04 pOTB7 BC008771 NM_017490 Full/var
HGY103695 IRAL059D23 pOTB7 BC084540 NM_004954 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023721 W01A059F01 pENTR-TOPO IRAL059D23 BC084540 NM_004954  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR163275 ARi08D03 pGCAP10 NM_004954.3  
GAGCAGGTCCGGCGGCGGCTGCCTGTGTGCCGGGCGCGGAGCAGTGCCGCTGAGGGCAGG
HKR171377 ARi28H09 pGCAP10 NM_004954.3  
GAGTGCCGCTGAGGGCAGGGGAGGAGCGAGGCAGGCGGCCGGCTGCGGCGGCAGACAGTA
HKR180851 ARi52C03 pGCAP10 NM_004954.3  
GGGGAGCAGCAGGTCCGGCGGCGGCTGCCTGTGTGCCGGGCGCGGAGCAGTGCCGCTGAG
HKR396828 RBd92B04 pGCAP10 NM_004954.3  
GGGAGCAGCAGGTCCGGCGGCGGCTGCCTGTGTGCCGGGCGCGGAGCAGTGCCGCTGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl