Prev. |  KEGG KO K13088 > 

RIKEN DNA Bank Human Resource - ELAVL1

Gene ID NCBI Gene 1994 |  KEGG hsa:1994
Gene Symbol ELAVL1
Protein Name ELAV like RNA binding protein 1
Synonyms ELAV1|HUR|Hua|MelG
Ortholog resource in our bank

  ELAVL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001511 IRAK003M23 pCMV-SPORT6 BC003376 NM_001419 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046500 ARe16E04 pKA1U5 NM_001419.2 done
GGCCGCTGCCGCCGTCGCCGTCGCCGCCACCGCCGCCACCGCTACCGAGGCCGAGCGGAG
HKR428225 RBdS070J09 pGCAP10 NM_001419.2 done
GGAGGAGGAGCCGCTGCCGCCGTCGCCGTCGCCGCCACCGCCGCCACCGCTACCGAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl