Prev. |  KEGG KO K03259 > 

RIKEN DNA Bank Human Resource - EIF4E

Gene ID NCBI Gene 1977 |  KEGG hsa:1977
Gene Symbol EIF4E
Protein Name eukaryotic translation initiation factor 4E
Synonyms AUTS19|CBP|EIF4E1|EIF4EL1|EIF4F|eIF-4E
Ortholog resources KEGG ortholog (KEGG orthology K03259) in the DNA Bank
Featured content HIF-1 signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029495 IRAK073M07 pBluescriptR BC035166 NM_001968 Full
HGY030608 IRAK076I16 pBluescriptR BC043226 NM_001968 Full
HGY087878 IRAL019L14 pDNR-LIB BC012611 NM_001968 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164836 ARi12B12 pGCAP10 NM_001968.2  
AGATCGATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCGAC
HKR234255 ARiS085K15 pGCAP10 NM_001968.2  
GAGATCGATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCGA
HKR324475 RBb11D03 pKA1U5 NM_001968.2  
TGAGATCGATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCG
HKR442079 RBdS105D07 pGCAP10 NM_001968.2  
GGTTGTGCGATCAGATCGATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl