Prev. |  KEGG KO K03257 > 

RIKEN DNA Bank Human Resource - EIF4A1

Gene ID NCBI Gene 1973 |  KEGG hsa:1973
Gene Symbol EIF4A1
Protein Name eukaryotic translation initiation factor 4A1
Synonyms DDX2A|EIF-4A|EIF4A|eIF-4A-I|eIF4A-I
Ortholog resource in our bank

  EIF4A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17295 pcDNA5/FRT/TO-SBP-eIF4A1 WT Mammalian inducible expression vector of SBP-tagged human eIF4A1, wild type using with the Flp-InTM T-RExTM system.
RDB17296 pcDNA5/FRT/TO-SBP-eIF4A1 Phe163Leu Mammalian inducible expression vector of SBP-tagged human eIF4A1, substitution (F163L) using with the Flp-InTM T-RExTM system.
RDB17297 pcDNA5/FRT/TO-SBP-eIF4A1 Ile199Met Mammalian inducible expression vector of SBP-tagged human eIF4A1, substitution (I199M) using with the Flp-InTM T-RExTM system.
RDB17298 pcDNA5/FRT/TO-SBP-eIF4A1 Phe163Leu-Ile199Met Mammalian inducible expression vector of SBP-tagged human eIF4A1 substitutions (F163L, I199M) using with the Flp-InTM T-RExTM system.
RDB17299 pColdI-eIF4A1 WT Bacterial expression vector of human eIF4A1, wild type.
RDB17300 pColdI-eIF4A1 Phe163Leu Bacterial expression vector of human eIF4A1 substitution (F163L).
RDB17301 pColdI-eIF4A1 Ile199Met Bacterial expression vector of human eIF4A1 substitution (I199M).
RDB17302 pColdI-eIF4A1 Phe163Leu-Ile199Met Bacterial expression vector of human eIF4A1 substitutions (F163L, I199M).
RDB17304 pHISMBP-eIF4A1-NTD (WT) Gateway based destinatin vector of human N-terminal region (NTD, 1-237) of eIF4A1 tagged with 6xHis and MBP at N-terminus.
RDB17305 pHISMBP-eIF4A1-NTD (Phe163Leu-Ile199Met) Gateway based destinatin vector of human N-terminal region (NTD, 1-237) of eIF4A1 substitutions (F163L, I199M) tagged with 6xHis and MBP at N-terminus.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088525 IRAL021F05 pDNR-LIB BC009585 NM_001416 Full
HGY103491 IRAL058M03 pOTB7 BC073752 NM_001416 Full
HGY080563 IRAL001G19 pOTB7 BC006210 NM_001416 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081624 M01C004A24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE081672 M01C004C24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE081720 M01C004E24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE081768 M01C004G24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE081816 M01C004I24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE081864 M01C004K24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE081912 M01C004M24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE081960 M01C004O24 pDONR221 04-134-2_2-F12 AK130082 XM_938121  
HGE105215 M01C063A15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE105263 M01C063C15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE105311 M01C063E15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE105359 M01C063G15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE105407 M01C063I15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE105455 M01C063K15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE105503 M01C063M15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE105551 M01C063O15 pDONR221 06_06-A08 AK130082 XM_938121  
HGE082843 M01C007B19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE082891 M01C007D19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE082939 M01C007F19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE082987 M01C007H19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE083035 M01C007J19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE083083 M01C007L19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE083131 M01C007N19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE083179 M01C007P19 pDONR221 FLJ01-C10 AK130082 XM_938121  
HGE085631 M01C014B07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085679 M01C014D07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085727 M01C014F07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085775 M01C014H07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085823 M01C014J07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085871 M01C014L07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085919 M01C014N07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085967 M01C014P07 pDONR221 FLJ04-G04 AK130082 XM_938121  
HGE085633 M01C014B09 pDONR221 FLJ04-G05 AK130082 XM_938121  
HGE085681 M01C014D09 pDONR221 FLJ04-G05 AK130082 XM_938121  
HGE085729 M01C014F09 pDONR221 FLJ04-G05 AK130082 XM_938121  
HGE085777 M01C014H09 pDONR221 FLJ04-G05 AK130082 XM_938121  
HGE085825 M01C014J09 pDONR221 FLJ04-G05 AK130082 XM_938121  
HGE085873 M01C014L09 pDONR221 FLJ04-G05 AK130082 XM_938121  
HGE085921 M01C014N09 pDONR221 FLJ04-G05 AK130082 XM_938121  
HGE085969 M01C014P09 pDONR221 FLJ04-G05 AK130082 XM_938121  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059749 ARe49G05 pKA1U5 NM_001416.2  
GCCCTAGNTTTCTAAGGATCATGCTCTGCGAGCCANGTATTCCCGATCCAGAGACAATGG
HKR067352 ARe68G08 pKA1U5 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR068803 ARe72A03 pKA1U5 NM_001416.2  
GCTAGATTTCTAAGGATCATGGTCTGCGAGCCAGGATTCCCGATCCNNAGACAATGGCCN
HKR070922 ARe77F02 pKA1U5 NM_001416.2  
GNTAGGTTTCTAAGGATCATGTTCTGCTAGCCAGGATTCCCGGATCCAGANACAATGGCC
HKR072812 ARe82A12 pKA1U5 NM_001416.2  
GAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGAT
HKR079630 ARe99B06 pKA1U5 NM_001416.2  
GCCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCC
HKR162900 ARi07E04 pGCAP10 NM_001416.2  
TGGAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGATGGGAT
HKR180948 ARi52G04 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR188001 ARi70A01 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR234138 ARiS085F18 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR264414 ARiS161A14 pGCAP10 NM_001416.2  
CGAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGA
HKR264642 ARiS161K02 pGCAP10 NM_001416.2  
GAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGAT
HKR324873 RBb12D01 pKA1U5 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR328404 RBb21A04 pKA1U5 NM_001416.2  
GCCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGCATTCCCGATCCAGAGACAATGGCCC
HKR330152 RBb25G08 pGCAP1 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR331233 RBb28B09 pGCAP1 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR367354 RBd18G10 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR370174 RBd25H06 pGCAP10 NM_001416.2  
GAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGAT
HKR371326 RBd28F06 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR371355 RBd28G11 pGCAP10 NM_001416.2  
AGAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGA
HKR372880 RBd32D08 pGCAP10 NM_001416.2  
GAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGAT
HKR378922 RBd47F02 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR388431 RBd71B07 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR389673 RBd74D01 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR390429 RBd76B05 pGCAP10 NM_001416.2  
AGTTTCCTNGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGG
HKR398102 RBd95E06 pGCAP10 NM_001416.2  
GAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCGAT
HKR416046 RBdS040B22 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG
HKR474814 RBdS187A14 pGCAP10 NM_001416.2  
GCTAGTTTCTAAGGATCATGTCTGCGAGCCAGGATTCCCGATCCAGAGACAATGGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.10.12

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl