Prev. |  KEGG KO K05103 > 

RIKEN DNA Bank Human Resource - EPHA2

Gene ID NCBI Gene 1969 |  KEGG hsa:1969
Gene Symbol EPHA2
Protein Name EPH receptor A2
Synonyms ARCC2|CTPA|CTPP1|CTRCT6|ECK
Featured content Axon guidance - human
Ortholog resource in our bank

  EPHA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07342 pGL4-phEPHA2 Promoter collection, Human EPHA2 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005206 IRAK013A06 pCMV-SPORT6 BC008655 NM_004431 Partial
HGY095959 IRAL039O23 pOTB7 BC037166 NM_004431 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008898 W01A022E02 pENTR-TOPO IRAL039O23 BC037166 NM_004431  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059302 ARe48E06 pKA1U5 NM_004431.2  
GATTAAGGACTCGGGGCAGGAGGGGCAGAAGTTGCGCGCAGGCCGGCGGGCGGGAGCGGA
HKR065675 ARe64D03 pKA1U5 NM_004431.2  
GATAAGGANTCGGGGCATGATGGGCATAAGTCGCTCGCAGGCCGGCGGGCGGNAGCGGAC
HKR174483 ARi36D11 pGCAP10 NM_004431.2  
GATTAAGGACTCGGGGCAGGAGGGGCAGAAGTTGCGCGCAGGCCGGCGGGCGGGAGCGGA
HKR344431 RBb61B07 pGCAP1 NM_004431.2  
GAGAGCAGTGGCGTGCGGAGCGGCGGCGGACCACCTCCAGTGGGACCTGATGCAGAACAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl