RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - EIF2B1

Gene ID	NCBI Gene 1967 \| KEGG hsa:1967
Gene Symbol	EIF2B1
Protein Name	eukaryotic translation initiation factor 2B subunit alpha
Synonyms	EIF2B\|EIF2BA\|EIF2Balpha\|VWM1

Link

Ortholog resource in our bank

EIF2B1

External database

human EIF2B1

Individualy Deposited Resource

Catalog number	Name of Resource	Description	CDS comparison
Catalog number	Name of Resource	Description	Refered (NCBI mRNA)	CDS status⁽¹⁾
RDB17722	pET28-3C-eIF2Ba	Bacterial expression vector of human eukaryotic translation initiation factor 2B subunit alpha (eIF2Balpha).

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR203383	ARiS008H15	pGCAP10	NM_001414.2	No cds
HKR203383	TTGGTGCGCCGGAAGTGGGGTGCGGAGGTGTGCAGCGCGCTGTCAGACTGGCTCGCAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.12.13

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl