Prev. |  KEGG KO K03239 > 

RIKEN DNA Bank Human Resource - EIF2B1

Gene ID NCBI Gene 1967 |  KEGG hsa:1967
Gene Symbol EIF2B1
Protein Name eukaryotic translation initiation factor 2B subunit alpha
Synonyms EIF2B|EIF2BA
Ortholog resource in our bank

  EIF2B1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17722 pET28-3C-eIF2Ba Bacterial expression vector of human eukaryotic translation initiation factor 2B subunit alpha (eIF2Balpha).
RDB18639 pEBMulti-Neo-human-eIF2alpha-PA Expression vector of human eIF2Balpha with PA-tag at C-terminus.
RDB18640 pEBMulti-Neo-human-eIF2alpha-S52A-PA Expression vector of human eIF2Balpha mutant (S52A) with PA-tag.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203383 ARiS008H15 pGCAP10 NM_001414.2 No cds done
TTGGTGCGCCGGAAGTGGGGTGCGGAGGTGTGCAGCGCGCTGTCAGACTGGCTCGCAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl