DNA Bank Top |  KEGG KO K03237 > 

RIKEN DNA Bank Human Resource - EIF2S1

Gene ID NCBI Gene 1965 |  KEGG hsa:1965
Gene Symbol EIF2S1
Protein Name eukaryotic translation initiation factor 2 subunit alpha
Synonyms EIF-2|EIF-2A|EIF-2alpha|EIF2|EIF2A
Featured content Apoptosis - human
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  EIF2S1


External database

human EIF2S1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB18640 pEBMulti-Neo-human-eIF2alpha-S52A-PA Expression vector of human eIF2alpha mutant (S52A) with PA-tag.    
RDB18639 pEBMulti-Neo-human-eIF2alpha-PA Expression vector of human eIF2alpha with PA-tag at C-terminus.    
RDB17725 pEBMulti-Neo-human-eIF2alpha Expression vector of human eukaryotic translation initiation factor 2 subunit alpha (eIF2alpha).    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081608 IRAL004A08 pOTB7 BC002513 NM_004094 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR065778 ARe64H10 pKA1U5 NM_004094.4  
GACGCTGAGGAGGATCGGCGGCCGGTGAGGGGGAAGCAAGTCTGGTCTCTGTGATTGAAG
HKR066954 ARe67G10 pKA1U5 NM_004094.4  
GGCTGAGGAGGATCGGCGGCCGGTGAGGGGGAAGCAAGTCTGGTCTCTGTGATTGAAGAA
HKR219939 ARiS049O03 pGCAP10 NM_004094.4  
ACGCTGAGGAGGATCGGCGGCCGGTGAGGGGGAAGCAAGTCTGGTCTCTGTGATTGAAGA
HKR333771 RBb34H03 pGCAP1 NM_004094.4  
GGGAGTGAGCGAAGCGCACGCTGCAGGAAGGATCGGCGGCCGGATGAGGGGGAAGCAAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.12.13

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl