Prev. |  KEGG KO K09203 > 

RIKEN DNA Bank Human Resource - EGR1

Gene ID NCBI Gene 1958 |  KEGG hsa:1958
Gene Symbol EGR1
Protein Name early growth response 1
Synonyms AT225|G0S30|KROX-24|NGFI-A|TIS8|ZIF-268|ZNF225
Ortholog resources KEGG ortholog (KEGG orthology K09203) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01198 ETR103 Human Egr- 1 cDNA, TPA early response gene
RDB05485 pKM2L-phEGR1 Promoter Bank clone, Human early growth response protein 1 (EGR1) promoter
RDB05835 pAxit-phEGR1-rLuc (F) Shuttle vector to generate recombinant adenovirus harboring renilla luciferase reporter.
RDB07369 pGL4-phEGR1 Promoter collection, Human EGR1 promoter

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX069933 IRAK174N21 pCMV-SPORT6 BC073983 NM_001964 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038833 W01A097B09 pENTR-TOPO IRAK174N21 BC073983 NM_001964  
HGE038841 W01A097B17 pENTR-TOPO IRAK174N21 BC073983 NM_001964 done
HGE038845 W01A097B21 pENTR-TOPO IRAK174N21 BC073983 NM_001964  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR014806 ARa37A06 pKA1U5 NM_001964.2  
GGAGAGATCCCAGCGCGCAGTAACTTGGGGAGCCGCCGCCGTCCATCCGCCGCCGCAGCC
HKR442169 RBdS105H01 pGCAP10 NM_001964.2  
GGAGAGATCCCAGCGCGCAGAACTTGGGGAGCCGCCGCCGCCATCCGCCGCCGCAGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl