Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EFNA1

Gene ID (NCBI) 1942
Gene Symbol EFNA1
Protein Name ephrin A1
Synonyms B61|ECKLG|EFL1|EPLG1|LERK-1|LERK1|TNFAIP4
Databases KEGG hsa:1942 |  NCBI Gene 1942
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05462)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04664 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1
RDB04670 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1
RDB04698 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1
RDB04706 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1
RDB04731 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1
RDB04735 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1
RDB05026 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1
RDB05027 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1
RDB05285 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027678 IRAK069D06 pCMV-SPORT6 BC032698 NM_004428 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE031753 W01A079G09 pENTR-TOPO flj0052o12 AK057845 NM_004428  
HGE031755 W01A079G11 pENTR-TOPO flj0052o12 AK057845 NM_004428  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163276 ARi08D04 pGCAP10 NM_004428.2  
GGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCTTCGGGGG
HKR046455 ARe16C07 pKA1U5 NM_004428.2  
TGAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCNGNTTCAGGCTTCGGGGGCCAGCCGCCG
HKR046456 ARe16C08 pKA1U5 NM_004428.2  
GAGTGGGAACCCAGACCCATAGGAGACCCGCGCTCCCCGCTCGGCCTGGCCAGGCCCCGC
HKR048456 ARe21C08 pKA1U5 NM_004428.2  
GGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCT
HKR050005 ARe25A05 pKA1U5 NM_004428.2  
GGGAAGTGGCCGGCTAGAGCCGGGGGCTGGGCGGGGACCGGGCTTGTCGGTGAAGCGGCA
HKR051683 ARe29D11 pKA1U5 NM_004428.2  
GGGGCGGGGACCGGGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAG
HKR053253 ARe33C05 pKA1U5 NM_004428.2  
TTGGTCGGTGAAGCGGCAGTGGCGGCGGCGGCCGCGGCTCGGCAGGCGGGTTCAGGCTTC
HKR058123 ARe45F03 pKA1U5 NM_004428.2  
GGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCTTCGG
HKR058579 ARe46H11 pKA1U5 NM_004428.2  
GGAGAGCGGAAGTGGCCGGCTAGAGCCGGGGGCTGGGCGGGGACCGGGCTTGTCGGTGAA
HKR062481 ARe56D09 pKA1U5 NM_004428.2  
GGAAGCGGCAGTGNCGGCGGCGGCGGCGGCNCCCCTGGACGGGTTCAGGCTTCGAGGGGC
HKR066011 ARe65A11 pKA1U5 NM_004428.2  
GGGCTCGGCAGGCGGGTTCAGGCTTCGGGGGCCAGCCGCCGCCATGATCCTGCTGGAGGT
HKR186052 ARi65C04 pGCAP10 NM_004428.2  
GGNCGGGGACCGGGCTTGTCGGTGANNGGCAGTGNNNNGGCGGCGNGNTCGGCNGNGGTN
HKR188499 ARi71E03 pGCAP10 NM_004428.2  
GGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCTTCGGGGGCCAGCCGCC
HKR218227 ARiS045J11 pGCAP10 NM_004428.2  
GGACCGGGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGNCAGGCTGNTN
HKR279220 ARiS198A20 pGCAP10 NM_004428.2  
HKR380429 RBd51B05 pGCAP10 NM_004428.2  
GGGACCGGGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl