DNA Bank Top |  KEGG KO K05462 > 

RIKEN DNA Bank Human Resource - EFNA1

Gene ID NCBI Gene 1942 |  KEGG hsa:1942
Gene Symbol EFNA1
Protein Name ephrin A1
Synonyms B61|ECKLG|EFL1|EPLG1|GMAN|LERK-1|LERK1|TNFAIP4
Featured content Axon guidance - human

Link

Ortholog resource in our bank

  EFNA1


External database

human EFNA1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05285 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1    
RDB05027 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1    
RDB05026 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1    
RDB04735 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1    
RDB04731 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1    
RDB04706 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1    
RDB04698 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1    
RDB04670 pAxCALNLhEFNA1(forward) Shuttle vector to generate rAd expressing human EFNA1    
RDB04664 pAxCALNLhEFNA1(reverse) Shuttle vector to generate rAd expressing human EFNA1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027678 IRAK069D06 pCMV-SPORT6 BC032698 NM_004428 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE031753 W01A079G09 pENTR-TOPO flj0052o12 AK057845 NM_004428  
HGE031755 W01A079G11 pENTR-TOPO flj0052o12 AK057845 NM_004428  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046455 ARe16C07 pKA1U5 NM_004428.2  
TGAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCNGNTTCAGGCTTCGGGGGCCAGCCGCCG
HKR046456 ARe16C08 pKA1U5 NM_004428.2  
GAGTGGGAACCCAGACCCATAGGAGACCCGCGCTCCCCGCTCGGCCTGGCCAGGCCCCGC
HKR048456 ARe21C08 pKA1U5 NM_004428.2  
GGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCT
HKR050005 ARe25A05 pKA1U5 NM_004428.2  
GGGAAGTGGCCGGCTAGAGCCGGGGGCTGGGCGGGGACCGGGCTTGTCGGTGAAGCGGCA
HKR051683 ARe29D11 pKA1U5 NM_004428.2  
GGGGCGGGGACCGGGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAG
HKR053253 ARe33C05 pKA1U5 NM_004428.2  
TTGGTCGGTGAAGCGGCAGTGGCGGCGGCGGCCGCGGCTCGGCAGGCGGGTTCAGGCTTC
HKR058123 ARe45F03 pKA1U5 NM_004428.2  
GGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCTTCGG
HKR058579 ARe46H11 pKA1U5 NM_004428.2  
GGAGAGCGGAAGTGGCCGGCTAGAGCCGGGGGCTGGGCGGGGACCGGGCTTGTCGGTGAA
HKR062481 ARe56D09 pKA1U5 NM_004428.2  
GGAAGCGGCAGTGNCGGCGGCGGCGGCGGCNCCCCTGGACGGGTTCAGGCTTCGAGGGGC
HKR066011 ARe65A11 pKA1U5 NM_004428.2  
GGGCTCGGCAGGCGGGTTCAGGCTTCGGGGGCCAGCCGCCGCCATGATCCTGCTGGAGGT
HKR163276 ARi08D04 pGCAP10 NM_004428.2  
GGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCTTCGGGGG
HKR186052 ARi65C04 pGCAP10 NM_004428.2  
GGNCGGGGACCGGGCTTGTCGGTGANNGGCAGTGNNNNGGCGGCGNGNTCGGCNGNGGTN
HKR188499 ARi71E03 pGCAP10 NM_004428.2  
GGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGTTCAGGCTTCGGGGGCCAGCCGCC
HKR218227 ARiS045J11 pGCAP10 NM_004428.2  
GGACCGGGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGNCAGGCTGNTN
HKR279220 ARiS198A20 pGCAP10 NM_004428.2  
HKR380429 RBd51B05 pGCAP10 NM_004428.2  
GGGACCGGGCTTGTCGGTGAAGCGGCAGTGGCGGCGGCGGCGGCGGCTCGGCAGGCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl