Prev. |  KEGG KO K03233 > 

RIKEN DNA Bank Human Resource - EEF1G

Gene ID NCBI Gene 1937 |  KEGG hsa:1937
Gene Symbol EEF1G
Protein Name eukaryotic translation elongation factor 1 gamma
Synonyms EF1G|GIG35
Ortholog resources KEGG ortholog (KEGG orthology K03233) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13267 pUC-T7-EMCV-His-eEF1Bgamma EMCV IRES-dependent expression vector of human eEF1Bgamma

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006199 IRAK015I07 pCMV-SPORT6 BC015813 NM_001404 Full
HGX025175 IRAK062P15 pCMV-SPORT6 BC028179 NM_001404 Full
HGY067270 IRAK168C22 pBluescriptR BC067738 NM_001404 Full
HGY080502 IRAL001E06 pOTB7 BC000384 NM_001404 Full
HGY080836 IRAL002B12 pOTB7 BC006509 NM_001404 Full
HGY084033 IRAL010B09 pOTB7 BC006520 NM_001404 Full
HGY088270 IRAL020L06 pOTB7 BC007949 NM_001404 Partial
HGY089702 IRAL024E06 pOTB7 BC021974 NM_001404 Partial
HGY090103 IRAL025E07 pOTB7 BC009865 NM_001404 Full
HGY092737 IRAL031O01 pDNR-LIB BC013918 NM_001404 Full/var
HGY096592 IRAL041H24 pDNR-LIB BC031012 NM_001404 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007110 W01A017M22 pENTR-TOPO IRAL041H24 BC031012 NM_001404  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040946 ARe02G02 pKA1U5 NM_001404.4  
GCCCTTTCNTTGCGGAATCACCATGGCGGCTGGCCACTTTGNTACACGNTATCCCGAAAA
HKR042571 ARe06H03 pKA1U5 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR042832 ARe07B08 pKA1U5 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCATGNTACACGTATCCTGAAAAC
HKR042834 ARe07B10 pKA1U5 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR043602 ARe09A02 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTGG
HKR044155 ARe10G11 pKA1U5 NM_001404.4  
GACCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAA
HKR045233 ARe13B09 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTGG
HKR045772 ARe14H04 pKA1U5 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR046802 ARe17A02 pKA1U5 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTG
HKR048171 ARe20H03 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTGG
HKR049749 ARe24G05 pKA1U5 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCNTGATACACGTATCCTGAAAACTG
HKR050482 ARe26D10 pKA1U5 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR050530 ARe26F10 pKA1U5 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTG
HKR052100 ARe30E04 pKA1U5 NM_001404.4  
TGCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR052873 ARe32D01 pKA1U5 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGGTATCCTGAAAAC
HKR054030 ARe35B06 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTGG
HKR054051 ARe35C03 pKA1U5 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR054546 ARe36G02 pKA1U5 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGNCCATTNATGNTACACGTATCCTGAAAA
HKR058027 ARe45B03 pKA1U5 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR062052 ARe55C04 pKA1U5 NM_001404.4  
GCCCCTTTTCTTTGCGGAATCACCATGGNCGGCTGGGTACCCTGATACACGTATCCTGAA
HKR065603 ARe64A03 pKA1U5 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACT
HKR066100 ARe65E04 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTGG
HKR068149 ARe70G05 pKA1U5 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTG
HKR069610 ARe74A10 pKA1U5 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTG
HKR071207 ARe78A07 pKA1U5 NM_001404.4  
GCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAAC
HKR072834 ARe82B10 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTGG
HKR073253 ARe83C05 pKA1U5 NM_001404.4  
CCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGCTATCCTGAAAACT
HKR073321 ARe83F01 pKA1U5 NM_001404.4  
GCCTTTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAA
HKR073673 ARe84D01 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTGG
HKR074010 ARe85A10 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTGG
HKR078431 ARe96B07 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAACTGG
HKR078805 ARe97A05 pKA1U5 NM_001404.4  
GCCCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTTATCCTGAAAA
HKR081627 ARf04B03 pKA1U5 NM_001404.4  
GCTTTTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAAA
HKR162809 ARi07A09 pGCAP10 NM_001404.4  
CCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR163756 ARi09G12 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR165681 ARi14D09 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR165778 ARi14H10 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR166080 ARi15D08 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR169207 ARi23A07 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR169730 ARi24F10 pGCAP10 NM_001404.4  
GCTTTTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAAC
HKR171252 ARi28C04 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR172577 ARi31H09 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR172952 ARi32G08 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR173769 ARi34H01 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR176126 ARi40F06 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR178431 ARi46B07 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR179679 ARi49D07 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTCCTTNTATCCTGAAAACTGG
HKR180075 ARi50D03 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACCCGTATCCTGAAAACTGG
HKR180850 ARi52C02 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR182058 ARi55C10 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR183625 ARi59B01 pGCAP10 NM_001404.4  
GCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAANCTG
HKR185605 ARi64A05 pGCAP10 NM_001404.4  
HKR186057 ARi65C09 pGCAP10 NM_001404.4  
TGGGCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR188429 ARi71B05 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACTATGGCGGCTGGGACCCTGTACCCCTATCCTGNTCTGTGC
HKR203385 ARiS008H17 pGCAP10 NM_001404.4  
GGAGAACCCCACCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTA
HKR208088 ARiS020D16 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR208214 ARiS020I22 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR209235 ARiS023B11 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR219825 ARiS049J09 pGCAP10 NM_001404.4  
GCCCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR219829 ARiS049J13 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR219891 ARiS049M03 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR234139 ARiS085F19 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR238714 ARiS096N02 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR238759 ARiS096O23 pGCAP10 NM_001404.4  
GCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR260077 ARiS150D05 pGCAP10 NM_001404.4  
GNTNCTTTTTTTTTTTTNTTTTTTTGNTTGCAGNNANCCNGNNNCCCTTTCCGGAAAAGC
HKR260156 ARiS150G12 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR260244 ARiS150K04 pGCAP10 NM_001404.4  
GCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR277888 ARiS194L24 pGCAP10 NM_001404.4  
GCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGAGGGC
HKR279368 ARiS198G24 pGCAP10 NM_001404.4  
HKR279583 ARiS198P23 pGCAP10 NM_001404.4  
HKR321250 RBb03C02 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTGG
HKR324497 RBb11E01 pKA1U5 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGATACACGTATCCTGAAAACTGG
HKR329326 RBb23F06 pGCAP1 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR331684 RBb29D12 pGCAP1 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR335779 RBb39H11 pGCAP1 NM_001404.4  
TGCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR336056 RBb40C08 pGCAP1 NM_001404.4  
GCCCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR343210 RBb58A10 pGCAP1 NM_001404.4  
GACCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGNTACACGTATCCTGAAA
HKR348459 RBb71C11 pGCAP1 NM_001404.4  
GCCCCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAAC
HKR348801 RBb72A01 pGCAP1 NM_001404.4  
HKR360833 RBd02B09 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR362451 RBd06C03 pGCAP10 NM_001404.4  
TTGGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGAGGGCCTTC
HKR362836 RBd07B12 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR366049 RBd15C01 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR366832 RBd17B08 pGCAP10 NM_001404.4  
GCCCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR368474 RBd21D02 pGCAP10 NM_001404.4  
GCCTTTCTTTGCTGAATCACCATGGCGGCTGGGACCCTGTACTCCTATCCTGAAAACTGG
HKR372901 RBd32E05 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR374436 RBd36B12 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR374483 RBd36D11 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR378008 RBd45A08 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR380459 RBd51C11 pGCAP10 NM_001404.4  
CGGCCGGCCGATGCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATC
HKR384578 RBd61H10 pGCAP10 NM_001404.4  
TGCTTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR388007 RBd70A07 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR388031 RBd70B07 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR395304 RBd88E08 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR403163 RBdS007P03 pGCAP10 NM_001404.4  
GNTTTCTTTGCNGAATCACCATGGCGGCTGGGANCCTGTACACGTATCCTGAAAACTGGA
HKR405679 RBdS014D07 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR406215 RBdS015I23 pGCAP10 NM_001404.4  
GCCTTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR409036 RBdS022J20 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR416355 RBdS040O19 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR420584 RBdS051H16 pGCAP10 NM_001404.4  
GCCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR441651 RBdS104C03 pGCAP10 NM_001404.4  
GCCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTG
HKR442132 RBdS105F12 pGCAP10 NM_001404.4  
GCTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR442163 RBdS105G19 pGCAP10 NM_001404.4  
GCTTTTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACT
HKR461673 RBdS154D01 pGCAP10 NM_001404.4  
GNTTTTTCTTTNNGGAATCNCCNTGGCGGCTGGNACCCTGNNCCCNTNTCCTGNNNNGTG
HKR462630 RBdS156J14 pGCAP10 NM_001404.4  
GCTTNNTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR471102 RBdS177M14 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA
HKR475015 RBdS187I23 pGCAP10 NM_001404.4  
GCCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGG
HKR475154 RBdS187O18 pGCAP10 NM_001404.4  
GCTTTCTTTGCGGAATCACCATGGCGGCTGGGACCCTGTACACGTATCCTGAAAACTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl