Prev. |  KEGG KO K03231 > 

RIKEN DNA Bank Human Resource - EEF1A2

Gene ID NCBI Gene 1917 |  KEGG hsa:1917
Gene Symbol EEF1A2
Protein Name eukaryotic translation elongation factor 1 alpha 2
Synonyms EEF1AL|EF-1-alpha-2|EF1A|EIEE33|HS1|MRD38|STN|STNL
Ortholog resource in our bank

  EEF1A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05484 pKM2L-phEF1A2 Promoter Bank clone, Human elongation factor 1 A-2 (EF1A-2) promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080441 IRAL001B17 pOTB7 BC000432 NM_001958 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR336410 RBb41A10 pGCAP1 NM_001958.2  
GCTCTGGCTGAGACCTCGGCTCCGGAATCACATGCAGCCCCCCTTCGCCCTGAGCCAGAG
HKR348971 RBb72H03 pGCAP1 NM_001958.2  
ATAAAACCGCCGGCGCCGGCGCCGCCAGTCCCTCTGGCTGAGACCTCGGCTCCGGAATCA
HKR368830 RBd22B06 pGCAP10 NM_001958.2  
GCTTTTTCGCANGGGTTTGCCGCCAGANCACAGGTGTCGTGAANCTACCCCTAAAGCCAA
HKR376835 RBd42B11 pGCAP10 NM_001958.2  
GCTCTGGCTGAGACCTCGGCTCCGGAATCACTGCAGCCCCCCTCGCCCTGAGCCAGAGCA
HKR383377 RBd58H09 pGCAP10 NM_001958.2  
GCCCTCTGGCTGAGACCTCGGCTCCGGAATCACTGCAGCCCCCNNNNNNCTGAGCCAGAG
HKR387608 RBd69A08 pGCAP10 NM_001958.2  
GCCCTCTGGCTGAGACCTCGGCTCCGGAATCACTGCAGCCCCCCTCGCCCTGAGCCAGAG
HKR432781 RBdS081P21 pGCAP10 NM_001958.2  
GCCCTCTGGCTGAGACCTCGGCTCCGGAATCACTGCAGCCCCCCTCGCCCTGAGCCAGAG
HKR471068 RBdS177L04 pGCAP10 NM_001958.2  
GNNNCTGGCTGANACCTCNNCTNCNGAATCNCTGCAGCNNCCNTCGCCNNGAGCCAGAGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl