RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - E2F5

Gene ID	NCBI Gene 1875 \| KEGG hsa:1875
Gene Symbol	E2F5
Protein Name	E2F transcription factor 5
Synonyms	E2F-5

Ortholog resource in our bank

  E2F5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR066426	ARe66B02	pKA1U5	NM_001951.3	VA
HKR066426	GACCGCGGGGCCGGGACGCGATGGCGGCGGCAGAGCCCGCGAGCTCGGGCCAGCAGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl