Prev. |  KEGG KO K17454 > 

RIKEN DNA Bank Human Resource - E2F1

Gene ID NCBI Gene 1869 |  KEGG hsa:1869
Gene Symbol E2F1
Protein Name E2F transcription factor 1
Synonyms E2F-1|RBAP1|RBBP3|RBP3
Featured content Mitophagy - human
Ortholog resource in our bank

  E2F1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05483 pKM2L-phE2F1(1) Promoter Bank clone, Human transcription factor E2F1 (E2F1) promoter
RDB05537 pKM2L-phE2F1(2) Promoter Bank clone, Human transcription factor E2F1 (E2F1) promoter
RDB07810 pGL4-phE2F1 Promoter collection, Human E2F1 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039409 IRAK098I17 pCMV-SPORT6 BC050369 NM_005225 Full
HGY087302 IRAL018E06 pOTB7 BC005098 NM_005225

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018183 W01A045H15 pENTR-TOPO IRAK098I17 BC050369 NM_005225 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR393722 RBd84F02 pGCAP10 NM_005225.2  
ACTTTGCAGGCAGCGGCGGCCGGGGGCGGAGCGGGATCGAGCCCTCGCCGAGGCCTGCCG
HKR475074 RBdS187L10 pGCAP10 NM_005225.2  
GACTTTGCNNGCAGCGGCGGCCGGGGGCGGANCGGGATCGAGCCCTCGCCGAGGCCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.11.09

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl