Prev. |  KEGG KO K02353 > 

RIKEN DNA Bank Human Resource - DVL3

Gene ID NCBI Gene 1857 |  KEGG hsa:1857
Gene Symbol DVL3
Protein Name dishevelled segment polarity protein 3
Synonyms DRS3
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Hippo signaling (human)
Featured content Notch signaling pathway (human)
Featured content Wnt signaling pathway (human)
Ortholog resource in our bank

  DVL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007915 IRAK019N03 pCMV-SPORT6 BC018289 NM_004423 Partial
HGX025782 IRAK064H14 pCMV-SPORT6 BC032459 NM_004423 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079745 ARe99G01 pKA1U5 NM_004423.3  
GGGGCCGCGCCGCGCGCCGCCGCCGTCTGGGAGGCTCGGCCCGGCCGCCCGAGCAGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl