Prev. |  KEGG KO K04459 > 

RIKEN DNA Bank Human Resource - DUSP4

Gene ID NCBI Gene 1846 |  KEGG hsa:1846
Gene Symbol DUSP4
Protein Name dual specificity phosphatase 4
Synonyms HVH2|MKP-2|MKP2|TYP
Ortholog resource in our bank

  DUSP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081390 IRAL003H22 pOTB7 BC014565 NM_001394 Full
HGY085043 IRAL012K03 pOTB7 BC002671 NM_001394 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025017 W01A062J01 pENTR-TOPO IRAL012K03 BC002671 NM_001394  
HGE025019 W01A062J03 pENTR-TOPO IRAL012K03 BC002671 NM_001394  
HGE025023 W01A062J07 pENTR-TOPO IRAL012K03 BC002671 NM_001394  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171325 ARi28F05 pGCAP10 NM_001394.5  
GCTGGCTGGGGCAGTGCGCTGAGCGCCGGAGGAGCGTAGGCAGGGCAGCGCTGGCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl