Prev. |  KEGG KO K17614 > 

RIKEN DNA Bank Human Resource - DUSP3

Gene ID NCBI Gene 1845 |  KEGG hsa:1845
Gene Symbol DUSP3
Protein Name dual specificity phosphatase 3
Synonyms VHR
Ortholog resource in our bank

  DUSP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04526 SEREX clone NGO-Co-12 (ID 2247) #1 SEREX clone NGO-Co-12 (ID 2247) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031620 IRAK079A20 pCMV-SPORT6 BC035701 NM_004090 Full/var
HGY085089 IRAL012M01 pOTB7 BC002682 NM_004090 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE036428 W01A091B04 pENTR-TOPO flj0062c19 AK129822 NM_004090  
HGE036444 W01A091B20 pENTR-TOPO flj0062c19 AK129822 NM_004090  
HGE036448 W01A091B24 pENTR-TOPO flj0062c19 AK129822 NM_004090  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046481 ARe16D09 pKA1U5 NM_004090.3  
TGGGCCGGGCGCTGCAGGGCCCCGCCGCCGCCATGTCGGGCTCGTTCGAGCTCTCGGTGC
HKR234921 ARiS087F01 pGCAP10 NM_004090.3  
GGTGCAGGGCCCCGCCGCCGCCATGTCGGGCTCGTTCGAGCTCTCGGTGCAGGATCTCAA
HKR243930 ARiS109N18 pGCAP10 NM_004090.3  
GGTGCAGGGCCCCGCCGCCGCCATGTCGGGCTCGTTCGAGCTCTCGGTGCAGGATCTCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl