Prev. |  KEGG KO K07597 > 

RIKEN DNA Bank Human Resource - DSG2

Gene ID NCBI Gene 1829 |  KEGG hsa:1829
Gene Symbol DSG2
Protein Name desmoglein 2
Synonyms CDHF5|HDGC
Ortholog resource in our bank

  DSG2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040976 ARe02H08 pKA1U5 NM_001943.3  
ATTTTCTCGCGGCGGCCACACCTGGAGCCGCGCCTTTNGGTTGGGCTGGGCTGGGCCGCG
HKR070948 ARe77G04 pKA1U5 NM_001943.3  
GGCGCGCTCGGGGCAGGCGGCGGCGCGGAGCGCNNTTGCGGCGGGAGGCGGAGGCGAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl