Prev. |  KEGG KO K06944 > 

RIKEN DNA Bank Human Resource - DRG2

Gene ID NCBI Gene 1819 |  KEGG hsa:1819
Gene Symbol DRG2
Protein Name developmentally regulated GTP binding protein 2
Synonyms -
Ortholog resource in our bank

  DRG2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080474 IRAL001D02 pOTB7 BC000493 NM_001388 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR013231 ARa33B07 pKA1U5 NM_001388.3  
GGGCTTCCGGGCGCACGCTACTCTGTCGCCGCCGTCAGACCGGAATTGCCGGTGCCGCCG
HKR397778 RBd94H10 pGCAP10 NM_001388.3  
GACTCTGTCGCCGCCGTCAGACCGGAATTGCCGGTGCCGCCGCCACCGCTGTCTGTGCGC
HKR441817 RBdS104J01 pGCAP10 NM_001388.3  
GGTCAGACCGGAATTGCCGGTGCCGCCGCCACCGCTGTCTGTGCGCCCACCTCTGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl