Prev. | 

RIKEN DNA Bank Human Resource - DR1

Gene ID NCBI Gene 1810 |  KEGG hsa:1810
Gene Symbol DR1
Protein Name down-regulator of transcription 1
Synonyms NC2|NC2-BETA|NC2B|NCB2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04617 SEREX clone NGO-Br-18 (ID 857, 824) #1 SEREX clone NGO-Br-18 (ID 857, 824) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066918 IRAK167E22 pBluescriptR BC068553 NM_001938 Full
HGY084878 IRAL012D06 pOTB7 BC002809 NM_001938 Full
HGY095681 IRAL039D09 pOTB7 BC035507 NM_001938 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000443 W01A001B19 pENTR-TOPO IRAL012D06 BC002809 NM_001938  
HGE000445 W01A001B21 pENTR-TOPO IRAL012D06 BC002809 NM_001938  
HGE000447 W01A001B23 pENTR-TOPO IRAL012D06 BC002809 NM_001938  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164807 ARi12A07 pGCAP10 NM_001938.2  
AAAAGGGTGTCGGGAGCGGCTTCCTGCAAACCTTCCCTGGCATCTGGAGGGACCACCGTT
HKR338176 RBb45H08 pGCAP1 NM_001938.2  
GAAACCTTCCCTGGCATCTGGAGGGACCACCGTTGCCGCGTCTTCGGCTTCCACGATCTG
HKR365627 RBd14B03 pGCAP10 NM_001938.2  
GGTCGGGAGCGGCTTCCTGCAAACCTTCCCTGGCATCTGGAGGGACCACCGTTGCCGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl