Prev. |  KEGG KO K17866 > 

RIKEN DNA Bank Human Resource - DPH2

Gene ID NCBI Gene 1802 |  KEGG hsa:1802
Gene Symbol DPH2
Protein Name diphthamide biosynthesis 2
Synonyms DPH2L2
Ortholog resource in our bank

  DPH2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081861 IRAL004K21 pOTB7 BC001389 NM_001384 Full
HGY083782 IRAL009H14 pOTB7 BC003181 NM_001384 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366097 RBd15E01 pGCAP10 NM_001384.4  
GAGTAGTTAGGATGGCTGAAGGGGATACTCACCGGCTGAAGGCCGACTGTGATTCCCCCT
HKR381298 RBd53E02 pGCAP10 NM_001384.4  
GAGTCCCACGTGTAGCGGAGAAACAGTAGTTAGGATGGCTGAAGGGGATACTCACCGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl