Prev. |  KEGG KO K14845 > 

RIKEN DNA Bank Human Resource - DXO

Gene ID NCBI Gene 1797 |  KEGG hsa:1797
Gene Symbol DXO
Protein Name decapping exoribonuclease
Synonyms DOM3L|DOM3Z|NG6|RAI1
Ortholog resource in our bank

  DXO

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044168 IRAK110G24 pCMV-SPORT6 BC050618 -
HGX047646 IRAK119B22 pCMV-SPORT6 BC058885 -
HGX066704 IRAK166M16 pCMV-SPORT6 BC071651 -
HGY090648 IRAL026K08 pOTB7 BC009344 -
HGY095740 IRAL039F20 pOTB7 BC019083 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR027731 ARa69F11 pKA1U5 NM_005510.3  
GGGTGTCAACCTCCTTCGTGAAGCTCACACCTCCCCCGCCCCGGGAGGGGTTTGCCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl