Prev. |  KEGG KO K14752 > 

RIKEN DNA Bank Human Resource - DOK1

Gene ID NCBI Gene 1796 |  KEGG hsa:1796
Gene Symbol DOK1
Protein Name docking protein 1
Synonyms P62DOK|pp62
Ortholog resource in our bank

  DOK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR329273 RBb23D01 pGCAP1 NM_001381.2 Full done
GGCANGGCCAGGCAAGCGCGGAAGGAACCGCCGGGGGCCATGGTACGGAGCAGTGATGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl