Prev. |  KEGG KO K10416 > 

RIKEN DNA Bank Human Resource - DYNC1LI2

Gene ID NCBI Gene 1783 |  KEGG hsa:1783
Gene Symbol DYNC1LI2
Protein Name dynein cytoplasmic 1 light intermediate chain 2
Synonyms DNCLI2|LIC2
Ortholog resource in our bank

  DYNC1LI2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY030556 IRAK076G12 pBluescriptR BC036633 NM_006141 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100841 M01C052B17 pDONR221 MGC15-G09 BC025959 NM_006141  
HGE100889 M01C052D17 pDONR221 MGC15-G09 BC025959 NM_006141  
HGE100937 M01C052F17 pDONR221 MGC15-G09 BC025959 NM_006141  
HGE100985 M01C052H17 pDONR221 MGC15-G09 BC025959 NM_006141  
HGE101033 M01C052J17 pDONR221 MGC15-G09 BC025959 NM_006141  
HGE101081 M01C052L17 pDONR221 MGC15-G09 BC025959 NM_006141  
HGE101129 M01C052N17 pDONR221 MGC15-G09 BC025959 NM_006141  
HGE101177 M01C052P17 pDONR221 MGC15-G09 BC025959 NM_006141  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR453064 RBdS132K24 pGCAP10 NM_006141.2  
GGCAGTTGGCAAGATGGCGCCGGTGGGGGTGGAGAAGAAGCTGCTGCTAGGTCCCAACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl