RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DNASE2

Gene ID	NCBI Gene 1777 \| KEGG hsa:1777
Gene Symbol	DNASE2
Protein Name	deoxyribonuclease 2, lysosomal
Synonyms	DNASE2A\|DNL\|DNL2
Featured content	Lysosome (human)

Ortholog resource in our bank

  DNASE2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB15793	MarX-puro-FLAG-Dnase2	Retroviral expression vector of human deoxyribonuclease 2, lysosomal (DNase2).
RDB18608	pCW DNAseIIα-sfGFP-T2A-mCherry	Lentiviral expression vector of lysosomal-METRIQ (MEasurement of protein Transporting integrity by RatIo Quantification) probe.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY084553	IRAL011G09	pOTB7	BC010419	NM_001375	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR070097	ARe75E01	pKA1U5	NM_001375.2
HKR070097	GTGATGTCCCCGCCCCGGTTCCCAGGCAAGTTTCNTTTAAGTGAAAGGCGCCAGGTGCCA
HKR364807	RBd12A07	pGCAP10	NM_001375.2
HKR364807	GACCCTCGTGATGTCCCCGCCCCGGTTCCCAGGCAAGTTTAGGGAAGTGAAAGGCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl