Prev. | Human A to Z list > D > 

RIKEN DNA Bank Human Resource - DNASE2

Gene ID (NCBI) 1777
Gene Symbol DNASE2
Protein Name deoxyribonuclease 2, lysosomal
Synonyms DNASE2A|DNL|DNL2
Databases KEGG hsa:1777 |  NCBI Gene 1777
Featured content Lysosome (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01158)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15793 MarX-puro-FLAG-Dnase2 Retroviral expression vector of human deoxyribonuclease 2, lysosomal (DNase2).

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX054372 IRAK135P12 pCMV-SPORT6(a) BC065209 NM_001375 Full
HGY084553 IRAL011G09 pOTB7 BC010419 NM_001375 Full

(1) Please refer Vector Information and Library Method Overviews at MGC.
(a)Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR070097 ARe75E01 pKA1U5 NM_001375.2  
GTGATGTCCCCGCCCCGGTTCCCAGGCAAGTTTCNTTTAAGTGAAAGGCGCCAGGTGCCA
HKR364807 RBd12A07 pGCAP10 NM_001375.2  
GACCCTCGTGATGTCCCCGCCCCGGTTCCCAGGCAAGTTTAGGGAAGTGAAAGGCGCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.02.26

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180829.pl