Prev. |  KEGG KO K10742 > 

RIKEN DNA Bank Human Resource - DNA2

Gene ID NCBI Gene 1763 |  KEGG hsa:1763
Gene Symbol DNA2
Protein Name DNA replication helicase/nuclease 2
Synonyms DNA2L|hDNA2
Ortholog resource in our bank

  DNA2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024842 IRAK062B18 pCMV-SPORT6 BC028188 XM_938629 Partial/var
HGX032823 IRAK082A23 pCMV-SPORT6 BC041115 XM_938629 Partial
HGX046018 IRAK115A18 pCMV-SPORT6 BC053574 XM_938629 Partial
HGX053634 IRAK134B10 pCMV-SPORT6 BC063664 XM_938629 Partial/var
HGX066727 IRAK166N15 pCMV-SPORT6 BC073945 XM_938629 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR181202 ARi53A02 pGCAP10 NM_001080449.1  
GCTACAGTTTGCGATCCCCGCGTCCAGGATGGAGCAGCTGAACGAACTGGAGCTGCTGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl