Prev. | 

RIKEN DNA Bank Human Resource - DMWD

Gene ID NCBI Gene 1762 |  KEGG hsa:1762
Gene Symbol DMWD
Protein Name DM1 locus, WD repeat containing
Synonyms D19S593E|DMR-N9|DMRN9|gene59
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082730 IRAL006N18 pOTB7 BC019266 NM_004943 Partial/var
HGY097709 IRAL044E13 pOTB7 BC041034 NM_004943

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178569 ARi46H01 pGCAP10 NM_004943.1  
GGCCCGGGGGGCGCCCAAGATGGCGGCGGGCGGCGCGGAGGGCGGCTCGGGCCCCGGCGC
HKR390853 RBd77C05 pGCAP10 NM_004943.1  
GGGGGCCCGGGGGGGCGCCCAAGATGGCGGCGGGCGGCGCGGAGGGCGGCTCGGGCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl