Prev. |  KEGG KO K01528 > 

RIKEN DNA Bank Human Resource - DNM1

Gene ID NCBI Gene 1759 |  KEGG hsa:1759
Gene Symbol DNM1
Protein Name dynamin 1
Synonyms DNM|EIEE31
Ortholog resources KEGG ortholog (KEGG orthology K01528) in the DNA Bank
Featured content Endocytosis (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019396 IRAK048I04 pBluescriptR BC050279 NM_004408 Full/var
HGX056494 IRAK141D22 pCMV-SPORT6 BC063850 NM_004408 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR376053 RBd40C05 pGCAP10 NM_001005336.1  
GGTCGGAGCCGGGAGCGCTAGCGGCAGCCGGATCGCAGCCTGCGGGGCCCGCCGCAGCCA
HKR384807 RBd62A07 pGCAP10 NM_001005336.1  
GGGAGTCGGAGCCGGGAGCGCTAGCGGCAGCCGGATCGCAGCCTGCGGGGCCCGCCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl