Prev. |  KEGG KO K21098 > 

RIKEN DNA Bank Human Resource - DLG3

Gene ID NCBI Gene 1741 |  KEGG hsa:1741
Gene Symbol DLG3
Protein Name discs large MAGUK scaffold protein 3
Synonyms MRX|MRX90|NEDLG|PPP1R82|SAP102|XLMR
Ortholog resources KEGG ortholog (KEGG orthology K21098) in the DNA Bank
Featured content Hippo signaling (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR470935 RBdS177F15 pGCAP10 NM_020730.2  
GAAAGCTCAGAGGCGCTCCTTGAGTTCATTCTTTTCCCATCTTTTCCCTTGTTTCCGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl