RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DLG3

Gene ID	NCBI Gene 1741 \| KEGG hsa:1741
Gene Symbol	DLG3
Protein Name	discs large MAGUK scaffold protein 3
Synonyms	MRX\|MRX90\|NEDLG\|PPP1R82\|SAP102\|XLMR
Featured content	Hippo signaling (human)

Ortholog resource in our bank

  DLG3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR470935	RBdS177F15	pGCAP10	NM_020730.2
HKR470935	GAAAGCTCAGAGGCGCTCCTTGAGTTCATTCTTTTCCCATCTTTTCCCTTGTTTCCGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl