Prev. |  KEGG KO K12075 > 

RIKEN DNA Bank Human Resource - DLG2

Gene ID NCBI Gene 1740 |  KEGG hsa:1740
Gene Symbol DLG2
Protein Name discs large MAGUK scaffold protein 2
Synonyms PPP1R58|PSD-93|PSD93|chapsyn-110
Featured content Hippo signaling (human)
Ortholog resource in our bank

  DLG2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE117215 M01C093A15 pDONR221 IMS10-A08 AK125151 NM_175892  
HGE117263 M01C093C15 pDONR221 IMS10-A08 AK125151 NM_175892  
HGE117311 M01C093E15 pDONR221 IMS10-A08 AK125151 NM_175892  
HGE117359 M01C093G15 pDONR221 IMS10-A08 AK125151 NM_175892  
HGE117407 M01C093I15 pDONR221 IMS10-A08 AK125151 NM_175892  
HGE117455 M01C093K15 pDONR221 IMS10-A08 AK125151 NM_175892  
HGE117503 M01C093M15 pDONR221 IMS10-A08 AK125151 NM_175892  
HGE117551 M01C093O15 pDONR221 IMS10-A08 AK125151 NM_175892  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374145 RBd35G01 pGCAP10 NM_001364.2  
GCCCTGTTCTCTTCGCGTCCTGCGGGAAAGATGGGGCGGCCCGAATGTTGTAATGTTACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl