Prev. |  KEGG KO K11131 > 

RIKEN DNA Bank Human Resource - DKC1

Gene ID NCBI Gene 1736 |  KEGG hsa:1736
Gene Symbol DKC1
Protein Name dyskerin pseudouridine synthase 1
Synonyms CBF5|DKC|DKCX|NAP57|NOLA4|XAP101
Ortholog resource in our bank

  DKC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084444 IRAL011B20 pOTB7 BC009928 NM_001363 Full/var
HGY090778 IRAL026P18 pOTB7 BC010015 NM_001363 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098025 M01C045B01 pDONR221 MGC12-C01 BC009928 ENST00000369550  
HGE098073 M01C045D01 pDONR221 MGC12-C01 BC009928 ENST00000369550  
HGE098121 M01C045F01 pDONR221 MGC12-C01 BC009928 ENST00000369550  
HGE098169 M01C045H01 pDONR221 MGC12-C01 BC009928 ENST00000369550  
HGE098217 M01C045J01 pDONR221 MGC12-C01 BC009928 ENST00000369550  
HGE098265 M01C045L01 pDONR221 MGC12-C01 BC009928 ENST00000369550  
HGE098313 M01C045N01 pDONR221 MGC12-C01 BC009928 ENST00000369550  
HGE098361 M01C045P01 pDONR221 MGC12-C01 BC009928 ENST00000369550  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366500 RBd16E04 pGCAP10 NM_001363.2  
TGGGTCGTTCCCTCGGCTGTGGACCGGGCGGCACGCACGCGGTGCAGGGTAACATGGCGG
HKR370431 RBd26B07 pGCAP10 NM_001363.2  
GGCGGCCTGACGGGACCAAGGCGGCGGGAGTCTGCGGTCGTTCCCTCGGCTGTGGACCGG
HKR430369 RBdS075P09 pGCAP10 NM_001363.2  
GGGTCGTTCCCTCGGCTGTGGACCGGGCGGCACGCACGCGGTGCAGGGTAACATGGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl