RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DIAPH2

Gene ID	NCBI Gene 1730 \| KEGG hsa:1730
Gene Symbol	DIAPH2
Protein Name	diaphanous related formin 2
Synonyms	DIA\|DIA2\|DRF2\|POF\|POF2\|POF2A

Ortholog resource in our bank

  DIAPH2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR049250	ARe23C02	pKA1U5	NM_007309.3	Full
HKR049250	GGTTGCGTCGGGGGTGCCTGGGAGCCTGGAGTCCCGGGGGCCTGAAATCGGCAGCTTCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl