Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NQO1

Gene ID (NCBI) 1728
Gene Symbol NQO1
Protein Name NAD(P)H quinone dehydrogenase 1
Synonyms DHQU|DIA4|DTD|NMOR1|NMORI|QR1
Databases KEGG hsa:1728 |  NCBI Gene 1728
Featured content Ortholog resources in the DNA Bank (KEGG orthology K00355)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07570 pGL4-phNQO1 Promoter collection, Human NQO1 promoter

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082090 IRAL005D18 pOTB7 BC007659 NM_000903 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078052 ARe95C04 pKA1U5 NM_000903.2  
GACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCC
HKR175707 ARi39E11 pGCAP10 NM_000903.2  
GACACGCGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTT
HKR176060 ARi40C12 pGCAP10 NM_000903.2  
GACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCC
HKR205290 ARiS013D18 pGCAP10 NM_000903.2  
GACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCC
HKR208380 ARiS020P20 pGCAP10 NM_000903.2  
GACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTT
HKR219818 ARiS049J02 pGCAP10 NM_000903.2  
GACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTTCCGG
HKR471061 RBdS177K21 pGCAP10 NM_000903.2  
GACACACGCGACTCCCACAAGGTTGCAGCCGGAGCCGCCCAGCTCACCGAGAGCCTAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl