Prev. |  KEGG KO K00326 > 

RIKEN DNA Bank Human Resource - CYB5R3

Gene ID NCBI Gene 1727 |  KEGG hsa:1727
Gene Symbol CYB5R3
Protein Name cytochrome b5 reductase 3
Synonyms B5R|DIA1
Ortholog resource in our bank

  CYB5R3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058130 ARe45F10 pKA1U5 NM_000398.5  
GGGTCTCGGCGGCGGCGGCGGCGGCGACAGAGCGAGCGCGGCGCGGGGCCACCATGGGGG
HKR062129 ARe55F09 pKA1U5 NM_000398.5  
GGGCGGCGGCGGCGACAGAGCGAGCGCGGCGCNCCTTTNANCATGGGGGCCCAGCATCAG
HKR072550 ARe81G06 pKA1U5 NM_000398.5  
GAGCGAGCGCGGCGCGGGGCCACCATGGGGGCCCAGCATCAGCACGTTGGGCCATATGGT
HKR081373 ARf03H05 pKA1U5 NM_000398.5  
TGGGGCCCGGGCGCGACGGTCTCGGCGGCGGCGGCGGCGGCGACAGAGCGAGCGCGGCGC
HKR082156 ARf05G12 pKA1U5 NM_000398.5  
GACGGTCTCGGCGGCGGCGGCGGCGGCGACAGAGCGAGCGCGGCGCGGGGCCACCATGGG
HKR164530 ARi11F10 pGCAP10 NM_000398.5  
GGCGGGCCCGGGCGCGACGGTCTCGGCGGCGGCGGCGGCGGCGACAGAGCGAGCGCGGCG
HKR166004 ARi15A04 pGCAP10 NM_000398.5  
GAGAGCGAGCGCGGCGCGGGGCCACCATGGGGGCCCAGCTCAGCACGTTGGGCCATATGG
HKR170176 ARi25H08 pGCAP10 NM_000398.5  
GCCGGGCGCGACGGTCTCGGCGGCGGCGGCGGCGGCGACAGAGCGAGCGCGGCGCGGGGC
HKR203446 ARiS008K06 pGCAP10 NM_000398.5  
GGCCCCTGCTCCGGAGTGACGCGGGCCCGGGCGCGACGGTCTCGGCGGCGGCGGCGGCGG
HKR218366 ARiS045P06 pGCAP10 NM_000398.5  
GGGCGGCGGCGGCGGCGGCGACAGAGCGAGCGCGGCGCGGGGCCACCATGGGGGCCCAGC
HKR320432 RBb01B08 pKA1U5 NM_000398.5  
GGCCCCTGCTCCGGAGTGACGCGGGCCCGGGCGCGACGGTCTCGGCGGCGGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl