Prev. |  KEGG KO K00287 > 

RIKEN DNA Bank Human Resource - DHFR

Gene ID NCBI Gene 1719 |  KEGG hsa:1719
Gene Symbol DHFR
Protein Name dihydrofolate reductase
Synonyms DHFRP1|DYR
Ortholog resource in our bank

  DHFR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005713 IRAK014E17 pCMV-SPORT6 BC009634 NM_000791 Partial/var
HGY082655 IRAL006K15 pOTB7 BC000192 NM_000791 Full
HGY082719 IRAL006N07 pOTB7 BC003584 NM_000791 Full
HGY103097 IRAL057M09 pDNR-LIB BC070280 NM_000791 Full/var
HGY103289 IRAL058D17 pOTB7 BC071996 NM_000791 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172812 ARi32A12 pGCAP10 NM_000791.3  
GGGGCTCGGAGGTCCTCCCGCTGCTGTCATGGTTGGTTCGCTAAACTGCATCGTCGCTGT
HKR234269 ARiS085L05 pGCAP10 NM_000791.3  
GGCGCCAAACTTGACCGCGCGTTCTGCTGTAACGAGCGGGCTCGGAGGTCCTCCCGCTGC
HKR388553 RBd71G09 pGCAP10 NM_000791.3  
GGGGAAGGCGGGCGCTGGGGGCGCTGCGGCCGCTGCAGCGCCAGGGTCCACCTGGTCGGC
HKR462583 RBdS156H15 pGCAP10 NM_000791.3  
GGGAGGTCCTCCCGCTGCTGTCATGGTTGGTTCGCTAAACTGCATCGTCGCTGTGTCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl