Prev. |  KEGG KO K09828 > 

RIKEN DNA Bank Human Resource - DHCR24

Gene ID NCBI Gene 1718 |  KEGG hsa:1718
Gene Symbol DHCR24
Protein Name 24-dehydrocholesterol reductase
Synonyms DCE|Nbla03646|SELADIN1|seladin-1
Ortholog resource in our bank

  DHCR24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085330 IRAL013F10 pOTB7 BC004375 NM_014762 Full
HGY090618 IRAL026J02 pOTB7 BC011669 NM_014762 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007619 W01A019A19 pENTR-TOPO IRAL026J02 BC011669 NM_014762  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068954 ARe72G10 pKA1U5 NM_014762.3  
GAGAGCGGGCCAGGCGCGGAGCTGGCGGCAGTGACATGAGGCGCGAACCCGCAGCGCTTA
HKR166576 ARi16H08 pGCAP10 NM_014762.3  
TGAGAGCGGGCCAGGCGCGGAGCTGGCGGCAGTGACAGGAGGCGCGAACCCGCAGCGCTT
HKR182008 ARi55A08 pGCAP10 NM_014762.3  
GAGGCGCGGAGCTGGCGGCACTGACAGGAGGCGCGAACCCGCAGCGCTTACCGCGCGGCG
HKR203208 ARiS008A08 pGCAP10 NM_014762.3  
GAGAGCGGGCCAGGCGCGGAGCTGGCGGCAGTGACAGGAGGCGCGAACCCGCAGCGCTTA
HKR222120 ARiS055E24 pGCAP10 NM_014762.3  
GGGGCTCCCCGGGCTGTGGGCTACAGGCGCAGAGCGGGCCAGGCGCGGAGCTGGCGGCAG
HKR277732 ARiS194F12 pGCAP10 NM_014762.3  
GGAGCGGGCCAGGCNCGGAGCTGGCGGCAGTGACAGGAGGCGCGAACCCGCAGCGCTTAC
HKR364169 RBd10H01 pGCAP10 NM_014762.3  
GAGAGCGGGCCAGGCGCGGAGCTGGCGGCAGTGACAGGAGGCGCGAACCCGCAGCGCTTA
HKR371356 RBd28G12 pGCAP10 NM_014762.3  
GAGAGCGGGCCAGGCGCGGAGCTGGCGGCAGTGACAGGAGGCGCGAACCCGCAGCGCTTA
HKR374953 RBd37G09 pGCAP10 NM_014762.3  
GAGGCGCGGAGCTGGCGGCAGTGACAGGAGGCGCGAACCCGCAGCGCTTACCGCGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl