Prev. |  KEGG KO K00213 > 

RIKEN DNA Bank Human Resource - DHCR7

Gene ID NCBI Gene 1717 |  KEGG hsa:1717
Gene Symbol DHCR7
Protein Name 7-dehydrocholesterol reductase
Synonyms SLOS
Ortholog resource in our bank

  DHCR7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082914 IRAL007E18 pOTB7 BC000054 NM_001360 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007449 W01A018K09 pENTR-TOPO IRAL007E18 BC000054 NM_001360  
HGE007451 W01A018K11 pENTR-TOPO IRAL007E18 BC000054 NM_001360  
HGE007455 W01A018K15 pENTR-TOPO IRAL007E18 BC000054 NM_001360  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046131 ARe15F11 pKA1U5 NM_001360.2  
GAGGCGGCGTGTAGCAGCGCGCGCAAGCGAGGCCAGGGGAAGGTGGGCGCAGGTGAGGGG
HKR052403 ARe31A03 pKA1U5 NM_001360.2  
GGCGGGTGACTTCGACCCCTGGCTAGAGGGTAGGCGGCGTGGAGCAGCGCGCGCAAGCGA
HKR062925 ARe57F05 pKA1U5 NM_001360.2  
GGGTAGGCGGCGTGTAGCAGCGCGCGCAAGCGAGGCCAGGGGAAGGTGGGCGCAGGTGAG
HKR179201 ARi48A01 pGCAP10 NM_001360.2  
GGCCCCTGCCCTGCGGGTGACTTCGACCCCTGGCTAGAGGGTAGGCGGCGTGGAGCAGCG
HKR348103 RBb70E07 pGCAP1 NM_001360.2  
GGCGGGTGACTCCGACCCCTGGCTAGAGGGTAGGCGGCGTGGAGCAGCGCGCGCAAGCGA
HKR374834 RBd37B10 pGCAP10 NM_001360.2  
GGCGGGTGACTCCGACCCCTGGCTAGAGGGTAGGCGGCGTGGAGCAGCGCGCGCAAGCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl