Prev. |  KEGG KO K00904 > 

RIKEN DNA Bank Human Resource - DGUOK

Gene ID NCBI Gene 1716 |  KEGG hsa:1716
Gene Symbol DGUOK
Protein Name deoxyguanosine kinase
Synonyms MTDPS3|NCPH|PEOB4|dGK
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  DGUOK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY093665 IRAL034C17 pOTB7 BC015757 NM_080916 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024226 W01A060J10 pENTR-TOPO IRAL034C17 BC015757 NM_080916  
HGE024228 W01A060J12 pENTR-TOPO IRAL034C17 BC015757 NM_080916  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049378 ARe23H10 pKA1U5 NM_080916.1  
GGCTGTGTGAATCGTGGGTGGGATGGCCGCGGGCCGCCTCTTTCTAAGTCGGCTTCGAGC
HKR052050 ARe30C02 pKA1U5 NM_080916.1  
GGCTCTCGGCGGAAGTGATCGCTGTGTGAATCGTGGGTGGGATGGCCGCGGGCCGCCTCT
HKR065676 ARe64D04 pKA1U5 NM_080916.1  
TTACCGGNTGAATCGTGGGNGNTATGCTNGCGCGCCGACTCCTAGNCAGNGGATCTACCA
HKR065726 ARe64F06 pKA1U5 NM_080916.1  
ATCCTGGGTGAATCGTGGGTGGGATGGCCGCGNGCCGCCTCTTTCTAAGTCGGCTTCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl