Prev. | 

RIKEN DNA Bank Human Resource - GSDME

Gene ID NCBI Gene 1687 |  KEGG hsa:1687
Gene Symbol GSDME
Protein Name gasdermin E
Synonyms DFNA5|ICERE-1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011641 IRAK029B17 pCMV-SPORT6 BC019689 NM_004403 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041281 ARe03D09 pKA1U5 NM_004403.2  
GGACTCCGCCAGCGCAGGGGGCGCGGCTGCCGGGGACCCAGCAGCGGGCGCGCGGATAAT
HKR046128 ARe15F08 pKA1U5 NM_004403.2  
TTGAGGGGGCGCGGCTGCCGGGGACCCAGCANCCGNCGCGCGGATAATCTGGAGCTTTCA
HKR052011 ARe30A11 pKA1U5 NM_004403.2  
GAGCGCAGGCTCCTCCGACTCCGCCAGCGCAGGGGGCGCGGCTGCCGGGGACCCAGCAGC
HKR052081 ARe30D09 pKA1U5 NM_004403.2  
GAGCGCAGGCTCCTCCGCACTCCGCCAGCGCAGGGGGCGCNGCTGCCGGGGTACCCATCA
HKR172524 ARi31F04 pGCAP10 NM_004403.2  
GAGGGGGCGCGGCTGCCGGGGACCCAGCAGCGGGCGCGCGGATAATCTGGAGCTTTCAAA
HKR235081 ARiS087L17 pGCAP10 NM_004403.2  
CGAGGGGGCGCGGCNGCCNGGNACCCANCAGCGGGCGCGCGGATAATCTGGAGCTTTCAA
HKR279371 ARiS198H03 pGCAP10 NM_004403.2  
NGGGGGNCCCAGCAGCGGGCGCGCGGATAATCTGGAGCTTTCAAAATGTTTGCCAAAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl