Prev. | Human A to Z list > D > 

RIKEN DNA Bank Human Resource - DFFA

Gene ID (NCBI) 1676
Gene Symbol DFFA
Protein Name DNA fragmentation factor subunit alpha
Synonyms DFF-45|DFF1|ICAD
Databases KEGG hsa:1676 |  NCBI Gene 1676
Featured content Ortholog resources in the DNA Bank (KEGG orthology K02310)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03581 pAxCALNLhDFF45 (forward) Shuttle vector to generate rAd harboring human DFF45 (forward)
RDB04148 pAxCALNLhDFF45 Shuttle vector to generate rAd harboring human DFF45
RDB04688 pAxCALNLhDFF45(reverse) Shuttle vector to generate rAd expressing human DFFA
RDB04690 pAxCALNLhDFF45(forward) Shuttle vector to generate rAd expressing human DFFA
RDB05078 pAxCALNLhDFF45(forward) Shuttle vector to generate rAd expressing human DFFA
RDB05350 pAxCALNLhDFF45 (forward) Shuttle vector to generate rAd harboring human DFF45 (forward)
RDB05351 pAxCALNLhDFF45 (reverse) Shuttle vector to generate rAd harboring human DFF45 (reverse)

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083129 IRAL007N17 pOTB7 BC000037 NM_004401 Full
HGY087104 IRAL017M16 pOTB7 BC007721 NM_004401 Full/var
HGY088534 IRAL021F14 pDNR-LIB BC007112 NM_004401 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR371370 RBd28H02 pGCAP10 NM_004401.2  
GACTTCTCGAAGGTGGGCAGGTCCCACCTTGTGGAGGATGGAGGTGACCGGGGACGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl