DNA Bank Top |  KEGG KO K02310 > 

RIKEN DNA Bank Human Resource - DFFA

Gene ID NCBI Gene 1676 |  KEGG hsa:1676
Gene Symbol DFFA
Protein Name DNA fragmentation factor subunit alpha
Synonyms DFF-45|DFF1|ICAD
Featured content Apoptosis - human

Link

Ortholog resource in our bank

  DFFA


External database

human DFFA

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05351 pAxCALNLhDFF45 (reverse) Shuttle vector to generate rAd harboring human DFF45 (reverse)    
RDB05350 pAxCALNLhDFF45 (forward) Shuttle vector to generate rAd harboring human DFF45 (forward)    
RDB05078 pAxCALNLhDFF45(forward) Shuttle vector to generate rAd expressing human DFFA    
RDB04690 pAxCALNLhDFF45(forward) Shuttle vector to generate rAd expressing human DFFA    
RDB04688 pAxCALNLhDFF45(reverse) Shuttle vector to generate rAd expressing human DFFA    
RDB04148 pAxCALNLhDFF45 (reverse) Shuttle vector to generate rAd harboring human DFF45    
RDB03581 pAxCALNLhDFF45 (forward) Shuttle vector to generate rAd harboring human DFF45 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088534 IRAL021F14 pDNR-LIB BC007112 NM_004401 Full
HGY087104 IRAL017M16 pOTB7 BC007721 NM_004401 Full/var
HGY083129 IRAL007N17 pOTB7 BC000037 NM_004401 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR371370 RBd28H02 pGCAP10 NM_004401.2  
GACTTCTCGAAGGTGGGCAGGTCCCACCTTGTGGAGGATGGAGGTGACCGGGGACGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl