Prev. |  KEGG KO K11273 > 

RIKEN DNA Bank Human Resource - DDX11

Gene ID NCBI Gene 1663 |  KEGG hsa:1663
Gene Symbol DDX11
Protein Name DEAD/H-box helicase 11
Synonyms CHL1|CHLR1|KRG2|WABS
Ortholog resource in our bank

  DDX11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004809 IRAK012A09 pCMV-SPORT6 BC011264 NM_030653 Full/var
HGY036486 IRAK091D14 pBluescript BC050069 NM_030653 Partial/var
HGX043169 IRAK107P09 pCMV-SPORT6 BC050522 NM_030653 Full/var
HGY084412 IRAL011A12 pOTB7 BC012834 NM_030653 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE105643 M01C064B19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE105691 M01C064D19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE105739 M01C064F19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE105787 M01C064H19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE105835 M01C064J19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE105883 M01C064L19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE105931 M01C064N19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE105979 M01C064P19 pDONR221 06_06-G10 BC050069 NM_030653  
HGE124412 M01C111A12 pDONR221 06-2_04-B06 BC050069 NM_030653  
HGE124460 M01C111C12 pDONR221 06-2_04-B06 BC050069 NM_030653  
HGE124508 M01C111E12 pDONR221 06-2_04-B06 BC050069 NM_030653  
HGE124556 M01C111G12 pDONR221 06-2_04-B06 BC050069 NM_030653  
HGE124604 M01C111I12 pDONR221 06-2_04-B06 BC050069 NM_030653  
HGE124652 M01C111K12 pDONR221 06-2_04-B06 BC050069 NM_030653  
HGE124700 M01C111M12 pDONR221 06-2_04-B06 BC050069 NM_030653  
HGE124748 M01C111O12 pDONR221 06-2_04-B06 BC050069 NM_030653  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR396553 RBd91G09 pGCAP10 NM_004399.2  
GGCGCAGCGGCGGGGGTTGTTCCGGCTGCCTTTCACTGAGGGGACCCGCCAGTTTCAAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl