Prev. |  KEGG KO K14776 > 

RIKEN DNA Bank Human Resource - DDX10

Gene ID NCBI Gene 1662 |  KEGG hsa:1662
Gene Symbol DDX10
Protein Name DEAD-box helicase 10
Synonyms Dbp4|HRH-J8
Ortholog resource in our bank

  DDX10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037526 IRAK093N14 pCMV-SPORT6 BC049217 NM_004398 Partial/var
HGX056193 IRAK140I01 pCMV-SPORT6 BC064921 NM_004398 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR388507 RBd71E11 pGCAP10 NM_004398.2  
GGTGCGTTTGTCCCATGCTGGTTCCGTGAGTCTGGCCTTAGGTGTCTCGTGTCTGGGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl